Novel Coronavirus Real Time Multiplex RT-PCR Nucleic Acid Kit

  • Brand: EB






Description

ZAlCu10 High precision Alu Cast Parts EB9090

Novel Coronavirus(2019-nCoV) Real Time Multiplex RT-PCR kit(Detection for 3 Genes)

Applications:

Real-Time Multiplex RT-PCR Kit is used for the qualitative detection. The principle of this real-time detection is based on the fluorogenic 5’ nuclease assay. During the PCR reaction, the DNA polymerase cleaves the probe at the 5’ end and separates the reporter dye from the quencher dye only when the probe hybridizes to the target DNA. This cleavage results in the fluorescent signal generated by the cleaved reporter dye, which is monitored in real-time by the PCR detection system.

The kit is for use with:

  1. ABI Prism®7000/7300/7500/7900/Step One Plus
  2. iCycler iQ™4/iQ™5
  3. Smart Cycler II
  4. Bio-Rad CFX 96
  5. Rotor Gene™6000
  6. Mx3000P/3005P
  7. MJ-Option2/Chromo4
  8. LightCycler®480 Instrument

User:

  1. Medical Institutions (hospital)
  2. Research Institutions
  3. Government CDC

Photos for Novel Coronavirus Real Time Multiplex RT-PCR kit :

Multiplex RT-PCR Nucleic Acid Kit

Used times:

25RXN/KIT

Package:

40KIT/CTN, CTN; Size:40cm*40cm*40cm, Weight 18kg

Price (Fob):

  1. 10000RXN-49999RXN:  $74.69/RXN;(Means $1867.25/KIT)
  2. 50000RXN-99999RXN:  $65.69/RXN;(Means $1642.25/KIT)
  3. Above 100000RXN,$56.69/RXN (Means $1417.25/KIT)

Primers and probes, real-time RT-PCR for 2019 novel coronavirus

Assay/use Oligonucleotide Sequencea Concentrationb
RdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction
RdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.

Use 100 nM per reaction and mix with P1

RdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.

Use 100 nM per reaction and mix with P2

RdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction
E gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction
E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction
E_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction
N gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction
N_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction
N_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction

Manufacturer certificate

Trading Terms:

  1. The nearest airport: Shanghai Pudong airport
  2. DHL, FEDEX, TNT, UPS are available
  3. The nearest seaport: Shanghai port
  4. Payment Terms:TT,Alipay,West Union,Paypal,L/C at sight
  5. Payment Condition:Less than USD 10,000 value, 100% payment before production. More than USD 10,001 value, 50% before production, 50% before delivery against complete set of inspection report
  6. Supply Capability: 500,000 pcs per day
  7. Sample Availability: yes
  8. Sample Time:15-30 Days
  9. Service: OEM, ODM or Customized

ZAlCu10 High precision Alu Cast Parts EB9090

  1. Friendly & High Efficient Technical & Commercial Communication
  2. Professional Export Practices: Exported to +60 Overseas Countries.

[carousel_slide id=’765′]